Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: Snd1 knockout mouse. (A) Schematic presentation of the Snd1 gene targeting. Shown is the wild type locus (WT), FloxP targeted locus, and the locus after Cre‐mediated recombination (Deleted locus). Red arrows indicate primers used in PCR‐based genotyping. (B) Quantitative Real‐Time PCR of Snd1 using RNA isolated from embryonic fibroblasts derived from wild type (+/+) and knockout (−/−) mice. (C) Western Blot analysis of Snd1 protein using embryonic fibroblasts derived from wild type and knockout mice. (D) Body weights of 2‐month‐old mice of indicated genotypes, nose to tail lengths, liver weights, body weight normalized liver weights, kidney weights of 2‐month old mice and testis weights of 2‐month old males. Littermates from offspring of heterozygous breeding pairs was used. Error bars indicate the standard error of the mean. The p ‐values are calculated using unpaired two‐tailed t ‐test and ( n ) indicates the number of animals of each genotype.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Knock-Out, Real-time Polymerase Chain Reaction, Isolation, Derivative Assay, Western Blot, Two Tailed Test

Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: Myeloid cell deficiency in mice lacking Snd1 . (A) Flow cytometric analysis of bone marrow Gr‐1+ granulocytes (left panel) and quantification of the numbers of Gr‐1+ granulocytes in bone marrow, and their granularity ( n = 8, right panel). 12‐week‐old male mice were used in the analyses. Error bars indicate the standard error of the mean and the p ‐values are calculated using two‐tailed Student's t ‐test. (B) Flow cytometric analysis of spleen Gr‐1+ granulocytes (left panel) and quantification of Gr‐1+ granulocyte numbers in spleen and quantification of highly granular Gr‐1+ cells ( n = 8, right panel). The quantification of spleen granulocytes was carried out as a pair‐wise comparison of the cell numbers within individual experiments, the number of WT cells set as 100%. (C) Flow cytometric analysis of the numbers of spleen CD11b+/F4/80+ mature macrophages (left panel) and quantification of the spleen mature macrophages ( n = 8, right panel). (D) May‐Grünwald Giemsa staining of blood leukocytes. Blood samples were treated with red blood cell lysis buffer (10 mM Tris–HCl, pH 7.4, 8.3 g/L NH 4 Cl, 1 mM EDTA) followed by Cytospin centrifugation to microscope slides and May‐Grünwald Giemsa staining. (E) Apoptosis is not significantly affected in cultured granulocytes of Snd1 KO. Bone marrow cells from WT and Snd1 KO mice were cultured for 2 h in RPMI medium supplemented with 10% fetal bovine serum, in the presence or absence of 10 μg/mL Cycloheximide (CHX) for increased apoptosis. Flow cytometric analysis was carried out for Gr‐1, Annexin V and Propidium Iodide (PI) stained cells. Early apoptotic cells are Annexin V‐positive and PI‐negative, whereas late apoptic/necrotic cells are positive for both Annexin V and PI.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Two Tailed Test, Comparison, Staining, Red Blood Cell Lysis, Centrifugation, Microscopy, Cell Culture

Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: Differential gene expression in spleen of the Snd1 knockout mice. (A) Duplicate RNA samples of WT and KO spleens from 8‐week‐old female mice were used in Illumina bead array gene expression analysis. The average fold‐change in gene expression of the most highly affected genes is shown. (B) Validation of the differential expression analysis. The average relative expression of Snd1 , Camp , Mpo , Prtn3 , Ela2 , Ngp and Serpina1b in spleens in WT and KO mice was assessed by qRT‐PCR. 8–12‐week‐old female mice (6 WT and 6 KO) were used. The level of expression of each gene in WT mice was set to 1. Error bars indicate the standard error of the mean. The p ‐values are calculated using paired two‐tailed t ‐test.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Gene Expression, Knock-Out, Biomarker Discovery, Quantitative Proteomics, Expressing, Quantitative RT-PCR, Two Tailed Test

Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: Differential gene expression in liver of the Snd1 knockout mice and comparison to gene expression changes in hypoxic environment. (A) Volcano plot of differential gene expression in Snd1 KO liver. Quadruplicate RNA samples of WT and KO livers from 8–12‐week‐old male mice were used in Illumina bead array gene expression analysis. (B) Average fold‐change in gene expression of the most highly affected genes. Statistical significance ( p ‐adjusted) is indicated in the parenthesis (* p adj < 0.05, ** p adj < 0.005, *** p adj < 0.001). Genes indicated by green and red color were found similarly deregulated in mouse livers in response to simulated high‐altitude hypoxic environment ²⁵ (green for downregulated and red for upregulated genes) (C) Western Blot (WB) detection of Snd1 protein in extracts from WT and KO livers. Duplicate samples were Coomassie Brilliant Blue stained (CBB) for total protein levels (D) Correlation analysis of genes differentially expressed in Snd1 KO liver and in high‐altitude hypoxic condition. Figure shows the common deregulated genes ( p < 0.05) in the expression analyses of WT vs. Snd1 KO liver and altitude of 1400 m vs. simulated altitude of 4500 m. Fold changes are presented as log2 values. (E) Small RNA‐seq analysis of differentially expressed miRNAs in the Snd1 KO liver. Quadruplicate RNA samples of WT and KO livers from 8–12‐week‐old male mice were used in the analysis. Listed are the most significantly differentially expressed miRNAs that includes the hypoxia‐responsive miRNA cluster miR‐96, −182 and − 183.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Gene Expression, Knock-Out, Comparison, Western Blot, Staining, Expressing, RNA Sequencing

Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: Mechanistic link between SND1, microRNAs miR‐96, miR‐182 and hypoxia (A) Expression levels of miR‐96‐5p and miR‐182‐5p in HEK‐293T SND1 KO cell clones and control clones (CO) in normal growth condition or in the presence of 1 mM DMOG. The values are from three independent experiments using 6–8 different WT and KO cell line clones. The horizontal line indicates the mean miRNA expression in the clones and the average expression of the CO clones is set as 1. miRNA expression was determined using qRT‐PCR analysis by normalizing to the U6 SnoRNA expression. The p ‐values are calculated using paired two‐tailed t ‐test. (B) The SND1 KO and control HEK‐293T cells were transfected with the HIF‐responsive HRE‐LUC reporter and treated, where indicated, with the HIF hydroxylase inhibitor DMOG (0.5 and 1.0 mM) to induce hypoxia‐mimicking conditions. The cells were harvested after three days of DMOG treatment to mimic chronic hypoxia and assayed for normalized luciferase activity. The data points are the average for each clone from four independent transfections and the horizontal lines indicate the mean and the standard error of the normalized activities of the clones. The average activity of the control clones in the absence of DMOG is set as 1. (C) HEK‐293T cells were transfected with the indicated microRNA mimics together with the HRE‐LUC reporter. The cells were treated, where indicated, with 1 mM DMOG for three days and harvested for analysis. The bars indicate the average normalized reporter activity from four independent transfections and the error bars indicate the standard deviation. The average activity of the control microRNA mimic in the presence of DMOG is set as 1.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Expressing, Clone Assay, Control, Quantitative RT-PCR, Two Tailed Test, Transfection, Luciferase, Activity Assay, Standard Deviation

Journal: FASEB BioAdvances

Article Title: The RNA ‐binding protein Snd1/ Tudor‐SN regulates hypoxia‐responsive gene expression

doi: 10.1096/fba.2022-00115

Figure Lengend Snippet: BioID analysis of Snd1 interacting proteins. (A) Western Blot analysis of HEK‐293T cells transiently transfected with either BioID2 or Snd1‐BioID2 expression vector and grown in either non‐stress condition (−) or 12 h of heat shock (HS, 42°C) or hypoxia (HYP, 2% oxygen). Lysates and biotinylated proteins captured with Avidin‐beads (Avidin‐pulldown) were resolved on SDS‐PAGE and blotted. Snd1‐BioID2 and the endogenous SND1 was detected with a Snd1 antibody (upper panel) and BioID2 with an antibody against Hemagglutinin A tag (HA, lower panel) (B) Detection of biotinylated proteins in the lysates and Avidin pulldown samples. Biotinylated proteins were detected with horseradish peroxidase –coupled Avidin (C) List of the identified Snd1 interacting/proximal proteins after Avidin‐pulldown and mass‐spectrometric identification. Listed are the identified proteins from non‐stressed growth condition, heat shock and hypoxia. The proteins that were identified also in the samples with empty BioID2 transfection are excluded from the list. The Mascot Score is relative to the number of identified peptides matching the protein. The proteins in the gene ontology ‐category of RNA‐binding proteins (GO: 0003723) are boxed and the proteins that are unique in each condition (non‐stressed, heat shock or hypoxia) are in bold (D) Gene ontology analysis of the identified putative Snd1 interacting proteins. PANTHER Overrepresentation Test (released 20181010) was used with GO Ontology database released 2018‐09‐06 with Fisher's Exact test with Bonferroni correction. (E) Visual presentation of the identified putative Snd1 interacting proteins sorted in cellular bodies and protein complexes. Proteins written in red were identified exclusively in heat shock and the protein in blue (FMR1) in hypoxia.

Article Snippet: To construct the Snd1‐BioID2 fusion, the full‐length mouse Snd1 cDNA (the mouse and human Snd1 sequence are 98% identical at the protein level) was PCR amplified using the primers CTCTACCGGTGCCATGGCCTCCTCCGCGCAGAGCAG (forward) and CTCTGGATCCGCGACTGTAGCCAAACTCATCAG (reverse) and cloned into AgeI and BamHI sites in the vector pcDNA3.1 MCS‐BioID2‐HA (a gift from Kyle Roux, Addgene plasmid #74224) to produce pcDNA3.1 Snd1‐BioID2‐HA.

Techniques: Western Blot, Transfection, Expressing, Plasmid Preparation, Avidin-Biotin Assay, SDS Page, RNA Binding Assay